|
|
bvrR from Brucella melitensis bv. 1 str. 16M |
| Victor ID |
1324 |
|
Gene Name |
bvrR from Brucella melitensis bv. 1 str. 16M |
|
Sequence Strain (Species/Organism) |
Brucella melitensis bv. 1 str. 16M |
|
NCBI Gene ID |
1197747
|
|
NCBI Protein GI |
17988319
|
|
Locus Tag |
BMEI2036 |
|
Protein Accession |
NP_540953.1 |
|
Other Database IDs |
UniProtKB-ID: D0B3X9_BRUME
UniRef100: UniRef100_D0B3X9
UniRef90: UniRef90_D0B3X9
UniRef50: UniRef50_P50351
UniParc: UPI00000582D7
EMBL: GG703778
EMBL-CDS: EEW88103.1
RefSeq_NT: NC_003317.1
OMA: PHLAIFD
|
|
Taxonomy ID |
224914
|
|
Chromosome No |
I |
|
Gene Starting Position |
2097414 |
|
Gene Ending Position |
2098133 |
|
Gene Strand (Orientation) |
- |
|
Protein Name |
TRANSCRIPTIONAL REGULATORY PROTEIN CHVI |
|
DNA Sequence |
>gi|17986284:2097414-2098133 Brucella melitensis bv. 1 str. 16M chromosome chromosome I, complete sequence
CTTACGCTTCCCGGAAACGATAACCGACGCCGTAGAGCGTTTCGATCATCTCGAAGCTGTCGTCAACCGC
CTTGAACTTCTTGCGCAGACGCTTGATGTGGCTGTCGATGGTGCGATCATCCACATAGACCTGTTCATCA
TAGGCCGCATCCATCAGGGCGTCACGGCTTTTGACCACGCCGGGGCGCTGGGCAAGTGAGTGAAGGATGA
GAAATTCGGTAACAGTCAGCGTAACCGGCTCACCCTTCCAGGTGCAGGTATGGCGCTCCTGATCCATGAC
GAGCTGTCCGCGCTCAAGGGACTTGGCCTGCTGGCCGGCGGGCTTTGCCGTGCCGTCGCGCGCCGCCACG
CGGCGCAGAACAGCCTTGACACGCTCGACCAGAAGACGCTGCGAAAAAGGCTTGGTGATGAAATCGTCCG
CCCCCATCTTGAGGCCGAAGAGTTCATCGATCTCATCGTCCTTGGAAGTGAGGAAGATGACCGGCAGATC
GGACTTCTGGCGCAGGCGGCGCAGAAGCTCCATACCGTCCATGCGCGGCATCTTGATATCGAAGATCGCA
AGATTGGGCGGACGCGCCATCAACCCATCCAGCGCAGAAGCGCCGTCGGTATAGGTTTCGACGCGATAAC
CTTCCGACTCCAGCGCAATGGAAACGGAGGTCAGGATGTTGCGGTCATCATCAACCAGCGCAATCGTCTG
CGTTGCCGAAGCTTCCTTCA
|
|
Protein Sequence |
>gi|17988319|ref|NP_540953.1| transcriptional regulatory protein chvI [Brucella melitensis bv. 1 str. 16M] MKEASATQTIALVDDDRNILTSVSIALESEGYRVETYTDGASALDGLMARPPNLAIFDIKMPRMDGMELLRRLRQKSDLPVIFLTSKDDEIDELFGLKMGADDFITKPFSQRLLVERVKAVLRRVAARDGTAKPAGQQAKSLERGQLVMDQERHTCTWKGEPVTLTVTEFLILHSLAQRPGVVKSRDALMDAAYDEQVYVDDRTIDSHIKRLRKKFKAVDDSFEMIETLYGVGYRFREA
|
|
Molecule Role |
Virulence factor |
|
Molecule Role Annotation |
MUTATION: The two-component BvrSBvrR system is essential for Brucella abortus virulence. Disruption of BvrSBvrR damages the outer membrane, thus contributing to the severe attenuation manifested by bvrS and bvrR mutants. The bvrS and bvrR mutants are avirulent in mice, show reduced invasiveness to epithelial cells and macrophages, and are incapable of inhibiting lysosome fusion and replicating intracellularly (Manterola et al., 2005).
Mutations in the bvrR or bvrS genes hamper the penetration of B abortus in non-phagocytic cells and impairs intracellular trafficking and virulence. BvrRBvrS mutants do not recruit small GTPases of the Rho subfamily required for actin polymerization and penetration to cells. Dysfunction of the BvrRBvrS system alters the outer membrane permeability, the expression of several group 3 outer membrane proteins and the pattern of lipid A acylation. Constructs of virulent B abortus chimeras containing heterologous LPS from the bvrS(-) mutant demonstrated an altered permeability to cationic peptides similar to that of the BvrRBvrS mutants. It is hypothesized that the Brucella BvrRBvrS is a system devoted to the homeostasis of the outer membrane and, therefore in the interface for cell invasion and mounting the required structures for intracellular parasitism (López-Goñi et al., 2002).
In contrast to S2308 and S19, bvrS and bvrR mutant strains poorly invade HeLa cells and are rapidly targeted to cathepsin D- containing compartments (Pizarro-Cerdá et al., 1998).
B abortus bvrS bvrR mutants display reduced invasiveness and virulence (Briones et al., 2001).
Brucella bvrS and bvrR null mutants are defective in several outer membrane proteins, mainly Omp3a (former Omp25) and Omp3b as well as in the structure of the LPS molecule, but the O chain seems to be intact (Gorvel and Moreno, 2002).
Because bvrR and bvrS mutants are also altered in cell-surface hydrophobicity, permeability, and sensitivity to surface- targeted bactericidal peptides, it is proposed that BvrRBvrS controls cell envelope changes necessary to transit between extracellular and intracellular environments (Guzman-Verri et al., 2002).
BvrR/BvrS mutants are avirulent in mice, show reduced invasiveness in cells, and are unable to inhibit lysosome fusion and to replicate intracellularly (Guzman-Verri et al., 2002). |
|
COG
|
COG0745TK, under T: Signal transduction mechanisms; K: Transcription |
| References |
Briones et al., 2001: Briones G, Iñón de Iannino N, Roset M, Vigliocco A, Paulo PS, Ugalde RA. Brucella abortus cyclic beta-1,2-glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infection and immunity. 2001; 69(7); 4528-4535. [PubMed: 11401996].
Gorvel and Moreno, 2002: Gorvel JP, Moreno E. Brucella intracellular life: from invasion to intracellular replication. Veterinary microbiology. 2002; 90(1-4); 281-297. [PubMed: 12414149].
Guzman-Verri et al., 2002: Guzman-Verri C, Manterola L, Sola-Landa A, Parra A, Cloeckaert A, Garin J, Gorvel JP, Moriyon I, Moreno E, Lopez-Goni I. The two-component system BvrR/BvrS essential for Brucella abortus virulence regulates the expression of outer membrane proteins with counterparts in members of the Rhizobiaceae. Proceedings of the National Academy of Sciences of the United States of America. 2002; 99(19); 12375-12380. [PubMed: 12218183].
López-Goñi et al., 2002: López-Goñi I, Guzmán-Verri C, Manterola L, Sola-Landa A, Moriyón I, Moreno E. Regulation of Brucella virulence by the two-component system BvrR/BvrS. Veterinary microbiology. 2002; 90(1-4); 329-339. [PubMed: 12414153].
Manterola et al., 2005: Manterola L, Moriyón I, Moreno E, Sola-Landa A, Weiss DS, Koch MH, Howe J, Brandenburg K, López-Goñi I. The lipopolysaccharide of Brucella abortus BvrS/BvrR mutants contains lipid A modifications and has higher affinity for bactericidal cationic peptides. Journal of bacteriology. 2005; 187(16); 5631-5639. [PubMed: 16077108].
Pizarro-Cerdá et al., 1998: Pizarro-Cerdá J, Méresse S, Parton RG, van der Goot G, Sola-Landa A, Lopez-Goñi I, Moreno E, Gorvel JP. Brucella abortus transits through the autophagic pathway and replicates in the endoplasmic reticulum of nonprofessional phagocytes. Infection and immunity. 1998; 66(12); 5711-5724. [PubMed: 9826346].
|
|
