|
|
bvrR from Brucella suis 1330 |
| Victor ID |
1112 |
|
Gene Name |
bvrR from Brucella suis 1330 |
|
Sequence Strain (Species/Organism) |
Brucella suis 1330 |
|
NCBI Gene ID |
1167793
|
|
NCBI Protein GI |
23502938
|
|
Locus Tag |
BR2090 |
|
Protein Accession |
NP_699065.1 |
|
Other Database IDs |
UniProtKB-ID: Q8FY04_BRUSU UniRef100: UniRef100_D0B3X9 UniRef90: UniRef90_D0B3X9 UniRef50: UniRef50_P50351 UniParc: UPI00000582D7 EMBL: AE014291 EMBL-CDS: AAN30980.1 RefSeq_NT: NC_004310.3 HSSP: P08402 GenomeReviews: AE014291_GR KEGG: bms:BR2090 TIGR: BR2090 HOGENOM: HBG753323 OMA: PHLAIFD ProtClustDB: CLSK864190 BioCyc: BSUI204722:BR_2090-MONOMER |
|
Taxonomy ID |
204722
|
|
Chromosome No |
I |
|
Gene Starting Position |
2013058 |
|
Gene Ending Position |
2013777 |
|
Gene Strand (Orientation) |
+ |
|
Protein Name |
DNA-binding response regulator BvrR, putative |
|
DNA Sequence |
>gi|56968325:2013058-2013777 Brucella suis 1330 chromosome I, complete sequence
CATGAAGGAAGCTTCGGCAACGCAGACGATTGCGCTGGTTGATGATGACCGCAACATCCTGACCTCCGTT
TCCATTGCGCTGGAGTCGGAAGGTTATCGCGTCGAAACCTATACCGACGGCGCTTCTGCGCTGGATGGGT
TGATGGCGCGTCCGCCCAATCTTGCGATCTTCGATATCAAGATGCCGCGCATGGACGGTATGGAGCTTCT
GCGCCGCCTGCGCCAGAAGTCCGATCTGCCGGTCATCTTCCTCACTTCCAAGGACGATGAGATCGATGAA
CTCTTCGGCCTCAAGATGGGTGCGGACGATTTCATCACCAAGCCTTTTTCGCAGCGTCTTCTGGTCGAGC
GTGTCAAGGCTGTTCTGCGCCGCGTGGCGGCGCGCGACGGCACGGCAAAGCCCGCCGGCCAGCAGGCCAA
GTCCCTTGAGCGCGGACAGCTCGTCATGGATCAGGAGCGCCATACCTGCACCTGGAAGGGTGAGCCGGTT
ACGCTGACTGTTACCGAATTTCTCATCCTTCACTCACTTGCCCAGCGCCCCGGCGTGGTCAAAAGCCGTG
ACGCCCTGATGGATGCGGCCTATGATGAACAGGTCTATGTGGATGATCGCACCATCGACAGCCACATCAA
GCGTCTGCGCAAGAAGTTCAAGGCGGTTGACGACAGCTTCGAGATGATCGAAACGCTCTACGGCGTCGGT
TATCGTTTCCGGGAAGCGTA
|
|
Protein Sequence |
>gi|23502938|ref|NP_699065.1| DNA-binding response regulator BvrR [Brucella suis 1330] MKEASATQTIALVDDDRNILTSVSIALESEGYRVETYTDGASALDGLMARPPNLAIFDIKMPRMDGMELLRRLRQKSDLPVIFLTSKDDEIDELFGLKMGADDFITKPFSQRLLVERVKAVLRRVAARDGTAKPAGQQAKSLERGQLVMDQERHTCTWKGEPVTLTVTEFLILHSLAQRPGVVKSRDALMDAAYDEQVYVDDRTIDSHIKRLRKKFKAVDDSFEMIETLYGVGYRFREA
|
|
Molecule Role |
Virulence factor |
|
Molecule Role Annotation |
MUTATION: The two-component BvrSBvrR system is essential for Brucella abortus virulence. Disruption of BvrSBvrR damages the outer membrane, thus contributing to the severe attenuation manifested by bvrS and bvrR mutants. The bvrS and bvrR mutants are avirulent in mice, show reduced invasiveness to epithelial cells and macrophages, and are incapable of inhibiting lysosome fusion and replicating intracellularly (Guzman-Verri et al., 2002).
Mutations in the bvrR or bvrS genes hamper the penetration of B abortus in non-phagocytic cells and impairs intracellular trafficking and virulence. BvrRBvrS mutants do not recruit small GTPases of the Rho subfamily required for actin polymerization and penetration to cells. Dysfunction of the BvrRBvrS system alters the outer membrane permeability, the expression of several group 3 outer membrane proteins and the pattern of lipid A acylation. Constructs of virulent B abortus chimeras containing heterologous LPS from the bvrS(-) mutant demonstrated an altered permeability to cationic peptides similar to that of the BvrRBvrS mutants. It is hypothesized that the Brucella BvrRBvrS is a system devoted to the homeostasis of the outer membrane and, therefore in the interface for cell invasion and mounting the required structures for intracellular parasitism (Guzman-Verri et al., 2002).
In contrast to S2308 and S19, bvrS and bvrR mutant strains poorly invade HeLa cells and are rapidly targeted to cathepsin D- containing compartments (Guzman-Verri et al., 2002).
B abortus bvrS bvrR mutants display reduced invasiveness and virulence (Guzman-Verri et al., 2002).
Brucella bvrS and bvrR null mutants are defective in several outer membrane proteins, mainly Omp3a (former Omp25) and Omp3b as well as in the structure of the LPS molecule, but the O chain seems to be intact (Guzman-Verri et al., 2002).
Because bvrR and bvrS mutants are also altered in cell-surface hydrophobicity, permeability, and sensitivity to surface- targeted bactericidal peptides, it is proposed that BvrRBvrS controls cell envelope changes necessary to transit between extracellular and intracellular environments (Guzman-Verri et al., 2002).
BvrR/BvrS mutants are avirulent in mice, show reduced invasiveness in cells, and are unable to inhibit lysosome fusion and to replicate intracellularly (Guzman-Verri et al., 2002). |
|
COG
|
COG0745TK, under T: Signal transduction mechanisms; K: Transcription |
| References |
Guzman-Verri et al., 2002: Guzman-Verri C, Manterola L, Sola-Landa A, Parra A, Cloeckaert A, Garin J, Gorvel JP, Moriyon I, Moreno E, Lopez-Goni I. The two-component system BvrR/BvrS essential for Brucella abortus virulence regulates the expression of outer membrane proteins with counterparts in members of the Rhizobiaceae. Proceedings of the National Academy of Sciences of the United States of America. 2002; 99(19); 12375-12380. [PubMed: 12218183].
|
|